Characterization of biovar/ races of Ralstonia solanacearum, the incitant of bacterial wilt in solanaceous crops
893 / 470
Abstract
A survey was conducted to study the status of bacterial wilt of solanaceous crops (potato, tomato, brinjal, chilli and capsicum) caused by R. solanacearum in Northern and Eastern states of India such as Jammu & Kashmir, Himachal Pradesh, Uttarakhand, Jharkhand and West Bengal. Bacterial wilt disease incidence in tomato and chilli was quite low 1 to 3 percent during summer season, whereas in rainy season, it was 4 to 60 percent in tomato and 3 to 40 per cent in brinjal. Disease incidence in tomato crop was more as compared to other solanaceous crops like brinjal, chilli, capsicum, and potato. Eighty four strains of R. solanacearum were collected from all the five states and 65 isolates were used for biovar /race characterization and molecular detection. Out of these 65 isolates, 58 were categorized as biovar 3 and remaining 7 biovar 4. The biovar 3 and 4, causing wilt in solanaceous crops belong to race 1. PCR with R. solanacearum specific primers Y2 (5’- CCCACTGCTGCCTCCCGTAGGAGT-3’) and OLI1 (5’GGGGGTAGCTTGCTACCTGCC3’) were used for molecular detection and all isolates amplified at 288bp. The primer was also able to distinguish the R. solanacearum from other saprophytic bacteria through colony PCR within 2 days.
Downloads
Issue
Section
License
For Authors
As soon as an article is accepted for publication, authors are requested to assign copyright of the article (or to grant exclusive publication and dissemination rights) to the publisher (Indian Phytopathlogical Society). This will ensure the widest possible protection and dissemination of information.
For Readers
While the advice and information in this journal is believed to be true and accurate at the date of its publication, the authors, the editors, nor the publisher can accept any legal responsibility for any errors or omissions that may have been made. The publisher makes no warranty, express or implied, with respect to the material contained herein.
All articles published in this journal are protected by copyright, which covers the exclusive rights to reproduce and distribute the article (e.g., as offprints), as well as all translation rights. No material published in this journal may be reproduced photographically or stored on microfilm, in electronic data bases, on video disks, etc., without first obtaining written permission from the publisher. The use of general descriptive names, trade names, trademarks, etc. in this publication, even if not specifically identified, implies that these names are protected by the relevant laws and regulations.