Development of specific primers for detection of Karnal bunt pathogen of wheat
374 / 126
Abstract
Karnal bunt (KB) of wheat caused by Tilletia indica has got prime importance as a quarantine disease although its impact is less on yield (0.3-0.5% loss) and the seed quality. Correct identification and detection of T. indica based on morphological features and germination of teliospores is time consuming. To avoid delay in detection and wrong identification of closely related species of T. indica from wheat seed lots, polymerase chain reaction (PCR) based species-specific primers were developed from rDNA-ITS region and 2.3kb mtDNA fragment of the pathogen. Two ITS primers viz., forward ITS KB F (5’ ACGGAGCTCTTCTTCGGA 3’) and reverse ITS KB R (5’ TCGATGATTCCGAAGAAT 3’) could specifically amplify 570bp amplicon of T. indica. Another primer set viz. forward mtDNA KB F (5’ CAATGTTGGCGTGGCGGCGC 3’) and reverse mtDNA KB R (5’ GGCGGACTACCACTCGAGCT 3’) amplified 885bp amplicon of KB pathogen only. Comparative study of both sets of speciesspecific primers (ITS KB F, ITS KB R and mtDNA KB F, mtDNA KB R) revealed that ITS primers had higher sensitivity, uniform amplification with single resolvable band than the mtDNA sequence based primers. The ITS primers could amplify spore DNA of T. indica obtained from 500 or more teliospores whereas mtDNA primers amplified 5000 or more teliospores DNA. This sensitive molecular tool can be most reliably employed by the seed producers and seed quality testers for detection of KB pathogen.
Downloads
Issue
Section
License
For Authors
As soon as an article is accepted for publication, authors are requested to assign copyright of the article (or to grant exclusive publication and dissemination rights) to the publisher (Indian Phytopathlogical Society). This will ensure the widest possible protection and dissemination of information.
For Readers
While the advice and information in this journal is believed to be true and accurate at the date of its publication, the authors, the editors, nor the publisher can accept any legal responsibility for any errors or omissions that may have been made. The publisher makes no warranty, express or implied, with respect to the material contained herein.
All articles published in this journal are protected by copyright, which covers the exclusive rights to reproduce and distribute the article (e.g., as offprints), as well as all translation rights. No material published in this journal may be reproduced photographically or stored on microfilm, in electronic data bases, on video disks, etc., without first obtaining written permission from the publisher. The use of general descriptive names, trade names, trademarks, etc. in this publication, even if not specifically identified, implies that these names are protected by the relevant laws and regulations.