Species specific mitochondrial Cytochrome c oxidase gene sequence of Manipuri pony


470 / 109

Authors

  • KSH. MIRANDA DEVI Assam University, Silchar, Asom 788 011 India
  • MONIKA AHANTHEM Assam University, Silchar, Asom 788 011 India
  • SANKAR KUMAR GHOSH Assam University, Silchar, Asom 788 011 India

https://doi.org/10.56093/ijans.v84i12.45383

Keywords:

Biodiversity, Cytochrome c oxidase, DNA barcode, Equidae, Manipuri pony

Abstract

The Manipuri pony, a unique indigenous horse breed of India, is known for its fastness, intelligence, surefooted moves and high endurance. The use of DNA barcodes, short DNA sequences from a standardized region of the mitochondrial (mt) genome, has recently been proposed as a tool to facilitate species identification. However, for this emblematic species, there is lacking in the development of DNA barcode which will remain as the molecular tag in the future. A specific molecular identification tag of Manipuri pony was developed under the Accession no. JN228963, and analysis within this family found that the individuals of a single species grouped closely together. Using a set of primer (forward-5´CCAACCACAAAGACATTGGCAC 3´ and reverse- 5´ CTTCTGGGTGGCAA AGAATCA 3´), PCR amplification based on the total genomic DNA extracted from hair samples of Manipuri pony gave an amplification product of 669bp which lies within the barcode region of COI gene of the mitochondrial genome. The partial sequence of COI gene, which is the DNA barcode of Manipuri pony will remain as the molecular identification mark for this species in the future. Additionally, it will also enhance the conservation of genetic resources of Manipuri pony. COI sequence divergence for conspecific individuals of Equidae family was 0.46%, whereas those for congeneric species averaged 6.75% (3.3% to 9.5%). The present finding reaffirmed a very close genetic similarity among the Equidae species. The results showed that analysis based on mt COI gene can be useful for explaining the phylogenetic relationships in the family Equidae.

Downloads

Download data is not yet available.

References

Aberle K S, Hamann H, Drogemuller C and Distl O. 2004. Genetic diversity in German draught horse breeds compared with a group of primitive, riding and wild horses by means of microsatellite DNA markers. Animal Genetics 35: 270–77. DOI: https://doi.org/10.1111/j.1365-2052.2004.01166.x

Achilli A, Olivieri A, Soares P, Lancioni H, Hooshiar K B, Perego U A, Nergadze S G, Carossa V, Santagostino M, Capomaccio S, Felicetti M, Al-Achkar W, Penedo M C, Verini-Supplizi A, Houshmand M, Woodward S R, Semino O, Silvestrelli M, Giulotto E, Pereira L, Bandelt H J and Torroni A. 2012. Mitochondrial genomes from modern horses reveal the major haplogroups that underwent domestication. Proceedings of the National Academy of Sciences of the United States of America 109: 2449–54. DOI: https://doi.org/10.1073/pnas.1111637109

Behl R, Behl J, Gupta N and Gupta S C. 2007. Genetic relationships of five Indian horse breeds using microsatellite markers. Animal 1: 483–88. DOI: https://doi.org/10.1017/S1751731107694178

Borisenko A V, Lim B K, Ivanova N V, Hanner R H and Hebert P D. 2008. DNA barcoding in surveys of small mammal communities: a field study in Suriname. Molecular Ecology Resources 8: 471–79. DOI: https://doi.org/10.1111/j.1471-8286.2007.01998.x

Clare E L, Lim B K, Fenton M B and Hebert P D. 2011. Neotropical bats: estimating species diversity with DNA barcodes. PLoS One 6: e22648. DOI: https://doi.org/10.1371/journal.pone.0022648

Gomez A, Wright P J, Lunt D H, Cancino J M, Carvalho G R and Hughes R N. 2007. Mating trials validate the use of DNA barcoding to reveal cryptic speciation of a marine bryozoan taxon. Proceedings of the Royal Society - Biological Sciences 274: 199–207. DOI: https://doi.org/10.1098/rspb.2006.3718

Hajibabaei M, Janzen D H, Burns J M, Hallwachs W and Hebert P D. 2006. DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of Sciences of the United States of America 103: 968–71. DOI: https://doi.org/10.1073/pnas.0510466103

Hebert P D, Ratnasingham S and deWaard J R. 2003a. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society - Biological Sciences 270 Suppl 1: S96–99. DOI: https://doi.org/10.1098/rsbl.2003.0025

Hebert P D, Cywinska A, Ball S L and deWaard J R. 2003b. Biological identifications through DNA barcodes. Proceedings of the Royal society - Biological Sciences 270: 313–21. DOI: https://doi.org/10.1098/rspb.2002.2218

Kakoi H, Tozaki T and Gawahara H. 2007. Molecular analysis using mitochondrial DNA and microsatellites to infer the formation process of Japanese native horse populations. Biochemical Genetics 45: 375–95. DOI: https://doi.org/10.1007/s10528-007-9083-0

Keyser-Tracqui C, Blandin-Frappin P, Francfort H P, Ricaut F X, Lepetz S, Crubezy E, Samashev Z and Ludes B. 2005. Mitochondrial DNA analysis of horses recovered from a frozen tomb (Berel site, Kazakhstan, 3rd Century BC). Animal Genetics 36: 203–09. DOI: https://doi.org/10.1111/j.1365-2052.2005.01316.x

Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111– 20. DOI: https://doi.org/10.1007/BF01731581

Lei C Z, Su R, Bower M A, Edwards C J, Wang X B, Weining S, Liu L, Xie W M, Li F, Liu R Y, Zhang Y S, Zhang C M and Chen H. 2009. Multiple maternal origins of native modern and ancient horse populations in China. Animal Genetics 40: 933–44. DOI: https://doi.org/10.1111/j.1365-2052.2009.01950.x

Lira J, Linderholm A, Olaria C, Brandstrom Durling M, Gilbert M T, Ellegren H, Willerslev E, Liden K, Arsuaga J L and Gotherstrom A. 2010. Ancient DNA reveals traces of Iberian Neolithic and Bronze Age lineages in modern Iberian horses. Molecular Ecology 19: 64–78. DOI: https://doi.org/10.1111/j.1365-294X.2009.04430.x

Lopes M S, Mendonca D, Cymbron T, Valera M, da Costa-Ferreira J and Machado Ada C. 2005. The Lusitano horse maternal lineage based on mitochondrial D-loop sequence variation. Animal Genetics 36: 196–202. DOI: https://doi.org/10.1111/j.1365-2052.2005.01279.x

Lorenzen E D, Arctander P and Siegismund H R. 2008. High variation and very low differentiation in wide ranging plains zebra (Equus quagga): insights from mtDNA and microsatellites. Molecular Ecology 17: 2812–24. DOI: https://doi.org/10.1111/j.1365-294X.2008.03781.x

Mittmann E H, Lampe V, Momke S, Zeitz A and Distl O. 2010. Characterization of a minimal microsatellite set for whole genome scans informative in warmblood and coldblood horse breeds. Journal of Heredity 101: 246–50. DOI: https://doi.org/10.1093/jhered/esp091

Oakenfull E A and Clegg J B. 1998. Phylogenetic relationships within the genus Equus and the evolution of alpha and theta globin genes. Journal of Molecular Evolution 47: 772–83. DOI: https://doi.org/10.1007/PL00006436

Orlando L, Metcalf J L, Alberdi M T, Telles-Antunes M, Bonjean D, Otte M, Martin F, Eisenmann V, Mashkour M, Morello F, Prado J L, Salas-Gismondi R, Shockey B J, Wrinn P J, Vasil’ev S K, Ovodov N D, Cherry M I, Hopwood B, Male D, Austin J J, Hanni C and Cooper A. 2009. Revising the recent evolutionary history of equids using ancient DNA. Proceedings of the National Academy of Sciences of the United States of America 106: 21754–59. DOI: https://doi.org/10.1073/pnas.0903672106

Paland S and Lynch M. 2006. Transitions to asexuality result in excess amino acid substitutions. Science 311: 990–92. DOI: https://doi.org/10.1126/science.1118152

Smith M A, Woodley N E, Janzen D H, Hallwachs W and Hebert P D. 2006. DNA barcodes reveal cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the National Academy of Sciences of the United States of America 103: 3657–62. DOI: https://doi.org/10.1073/pnas.0511318103

Tamura K, Dudley J, Nei M and Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596–99. DOI: https://doi.org/10.1093/molbev/msm092

Vernooy R, Haribabu E, Muller M R, Vogel J H, Hebert P D, Schindel D E, Shimura J and Singer G A. 2010. Barcoding life to conserve biological diversity: beyond the taxonomic imperative. PLoS Biology 8: e1000417. DOI: https://doi.org/10.1371/journal.pbio.1000417

Ward R D, Zemlak T S, Innes B H, Last P R and Hebert P D. 2005. DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B - Biological Sciences 360: 1847–57. DOI: https://doi.org/10.1098/rstb.2005.1716

Xu S, Luosang J, Hua S, He J, Ciren A, Wang W, Tong X, Liang Y, Wang J and Zheng X. 2007. High altitude adaptation and phylogenetic analysis of Tibetan horse based on the mitochondrial genome. Journal of Genetics and Genomics 34: 720–29. DOI: https://doi.org/10.1016/S1673-8527(07)60081-2

Downloads

Submitted

2014-12-19

Published

2014-12-19

Issue

Section

Articles

How to Cite

DEVI, K. M., AHANTHEM, M., & GHOSH, S. K. (2014). Species specific mitochondrial Cytochrome c oxidase gene sequence of Manipuri pony. The Indian Journal of Animal Sciences, 84(12), 1283–1288. https://doi.org/10.56093/ijans.v84i12.45383
Citation